You always be there~

Always Be There Lyrics

By: Maher Zain

Alllahu Akbar…

If you ask me about love
And what i know about it
My answer would be
It’s everything about Allah
The pure love, to our souls
The creator of you and me,the heaven and whole universe
The one that made us whole and free
The guardian of HIS true believers
So when the time is hard
There’s no way to turn
As HE promise HE will always be there
To bless us with HIS love and HIS mercy
Coz, as HE promise HE will always be there
HE’s always watching us, guiding us

So when the time is hard
There’s no way to turn
As HE promise HE will always be there
To bless us with HIS love and HIS mercy
Coz, as HE promise HE will always be there
HE’s always watching us, guiding us
And HE knows what’s in all in our heart

So when you lose your way
To Allah you should turn
As HE promise HE will always be there…

HE bring ourselves from the darkness into the light
Subhanallah praise belongs to YOU for everything
Shouldn’t never feel afraid of anything
As long as we follow HIS guidance all the way
Through the short time we have in this life
Soon it all’ll be over
And we’ll be in His heaven and we’ll all be fine

So when the time gets hard
There’s no way to turn
As HE promise He will always be there
To bless us with HIS love and HIS mercy
Coz, as HE promise HE will always be there
HE’s always watching us, guiding us
And HE knows what’s in all in our heart

So when you lose your way
To Allah you should turn
As HE promise HE will always be there…

Allahu Akbar…

So when the time gets hard
There’s no way to turn
As HE promise He will always be there
To bless us with HIS love and HIS mercy
Coz, as HE promise HE will always be there
HE’s always watching us, guiding us
And he knows what’s in all in our heart

So when you lose your way
To Allah you should turn
As HE promise HE will always be there…

Allahu Akbar…

Video & Lyrics Information

Artist: Maher Zain
Album: Thank You Allah
Lyrics: Bilal Hajji & Maher Zain
Melody: Maher Zain
Arrangement: N/A
Copyright: Awakening Records 2009

Aktivitiku

Hobi baru:

Hobi ke??erk..Hari ni genap seminggu aku drive keta kt kwsn yg memang strategik sgt dgn traffic jam.macam2 perasaan rasanya bwk keta kt area ni.hari mula2 nk start bawak keta memang sgt mendebarkan.masakan tidak sebelum ni aku xpernah pun drive seorang diri.memang mendebarkan bila aku terpaksa drive sorang2 dari rumah mak sepupuku di keramat sampai la ke rumahku dkt USJ2.tp alhamdulillah xde ape2 yg buruk berlaku.memang betul2 mencabar..

Tutorial 1 recombinant:

List the complete of bacterial gene sequence including with its promoter, shine Dalgarno, start site and open reading frame (ORF).What is difference between strong and weak promoter?What are small and large gene products of human, bacteria, drosophila, yeast, primitive and flowering plants?waaaaaaaaaaa......matila..benda ape ni?cmne nk tau betul salah?blajar pn tak hbs lg..bak kate Prof Ben.."Don't worry..I took 30 years to learn all of these.."What??kalo cmtu aku pn kna amik masa 30 thn gak la nk complete assignment ni..hu3..

Ini adalah sebahagian daripada sequence E.coli yang aku ambik daripada BLAST.aku sendiri pun xtau sequences ni stand for what kind of genes.tapi selepas bertungkus lumus mencari journal akhirnya dpt gak aku find satu gene iaitu trpE gene.siap dengan promoternye skali.dengan pertolongan dari kawan2 aku dpt gak aku kumpulkan keempat2 gene iaitu dua strong promoter dan dua weak promoter.tapi yang ni baru part A.tak masuk lagi part B.hu3..cmne lah nk jadi scientist.lama2 tgk sequence ni blh pecah kepala..

CATTATCGACTTTTGTTCGAGTGGAGTCCGCCGTGTCACTTTCGCTTTGGCAGCAGTGTCTTGCCCGATTGCAGGATGAGTACCAGCCACAGAATTCAGTATGTGGATACGCCCATTGCAGGCGGAACTGAGCGATAACACGCTGGCCCTGTACGCGCCAAACGTTTTGTCCTCGATTGGGTACGGGACAAGTACCTTAATAATATCAATGGACTGCTAACCAGTTTCTGCGGAGCGGATGCCCCACAGCTGCGTTTTGAAGTCGGCACCAAACCGGTGACGCAAACGCCACAAGCGGCAGTGACGAGCAACGTCGCGGCCCCTGCACAGGTGGCGCAAACGCAGCCGCAACGTGCTGCGCCTTCTACGCGCTCAGGTTGGGATAACGTCCCGGCCCCGGCAGAACCGACCTATCGTTCTAACGTAAACGTCAAACACACGTTTGATAACTTCGTTGAAGGTAAATCTAACCAACTGGCGCGCGCGGCGGCTCGCCAGGTGGCGGATAACCCTGGCGGTGCCTATAACCCGTTGTTCCTTTATGGCGGCACGGGTCTGGGTAAAACTCACCTGCTGCATGCGGTGGGTAACGGCATTATGGCGCGCAAGCCGAATGCCAAAGTGGTTTATATGCACTCCGAGCGCTTTGTTCAGGACATGGTTAAAGCCCTGCAAAACAACGCGATCGAAGAGTTTAAACGCTACTACCGTTCCGTAGATGCACTGCTGATCGACGATATTCAGTTTTTTGCTAATAAAGAACGATCTCAGGAAGAGTTTTTCCACACCTTCAACGCCCTGCTGGAAGGTAATCAACAGATCATTCTCACCTCGGATCGCTATCCGAAAGAGATCAACGGCGTTGAGGATCGTTTGAAATCCCGCTTCGGTTGGGGACTGACTGTGGCGATCGAACCGCCAGAGCTGGAAACCCGTGTGGCGATCCTGATGAAAAAGGCCGACGAAAACGACATT...