Jom Click

Jumaat, 31 Disember 2010

Menanti belahan jiwa


Kegelisahan, kedukaan dan air mata adalah sebahagian daripada sketsa hidup dan kehidupan kita sekalian hamba di dunia ini. Titisan air mata yang bermuara dari hati dan berselaputkan kegelisahan jiwa terkadang memilukan hingga mencipta keresahan dan kebimbangan. Kedukaan kerana kerinduan yang teramat sangat dalamnya menyebabkan kepedihan yang menyesakkan ruang dada. Jiwa yang rapuh pun mengadu, berkeluh-kesah pada alam serta isinya,bertanya di manakah pasangan jiwa berada. Lalu hati mencipta serpihan kegelisahan, bagai anak kecil yang kehilangan ibunya.

Keinginan bertemu pasangan jiwa, bukankah itu sebuah fitrah seorang hamba? Semua itu hadir tanpa disedari sebelumnya hingga tanpa sedar telah menjadi sebahagian hidup yang tidak boleh dipisahkan lagi. Letih... Sungguh letih jiwa raga. Sendiri mengayuh biduk kecil dengan rasa hampa tanpa tahu adakah belahan jiwa di luar sana? Alahai... kehidupan manusia bukan hanya untuk dunia fana ini sahaja kerana masih ada akhirat yang kekal abadi. Memang, setiap manusia telah diciptakan berpasangan, namun tak hanya dibatasi oleh dunia fana ini sahaja. Seseorang yang belum menemui pasangan jiwanya,Insyaallah akan dipertemukan suatu hari nanti.

Keresahan dan kegelisahan janganlah sampai mengubah pandangan kepada Pemilik Cinta. Berserahlah kepada Maha Pemurah. Kembalikan segala urusan hanya kepadanya, kerana Dia Maha Memberi dan Maha Pengasih. Ikhtiar, munajat serta untaian doa tiada habis-habisnya dicurahkan kepada Pemilik Hati. Tak usah membandingkan diri dengan orang lain kerana Dia pasti memberikan yang terbaik untuk setiap hamba-Nya, meskipun adakalanya kita sekalian hamba tidak menyedarinya.

Usahlah dirimu bersedih lalu menangis di penghujung malam kerana tak kunjung usai memikirkan siapa kiranya pasangan jiwa. Menangislah kerana air mata permohonan kepada-Nya di setiap sujud dan keheningan pekat malam. Jadikan hidup ini penuh dengan harapan yang baik kepada Pemilik Jiwa. Bersiap menghadapi putaran waktu hingga setiap gerak langkah serta helaan nafas bernilai ibadah kepada Maha Pencipta. Bukankah kalau sudah saatnya tiba, jodoh tidak akan lari ke mana kerana sejak roh telah menyatu dengan jasad, siapa belahan jiwamu telah tersurat.

Sabarlah, bukankah mentari akan selalu menghiasi pagi dan malam senantiasa indah dengan sinar lembut rembulan dipagar bintang. Senyum dan hapuskanlah air matamu serta hilangkanlah lara di jiwa. Terimalah semua sebagai sebahagian kembara kehidupan yang akan menemui rahsia di sebalik titian kehidupan yang kau jalani. Hingga, kelak kau akan rasakan tidak ada lagi riak kegelisahan dan keresahan saat bersendirian.

- Artikel iluvislam.com

Selasa, 21 Disember 2010

study2!!

Assalamualaikum w.b.t..

dh lame blog ni trbiar.hurm..slalu bukak tp xtau nk mngarang crite ape.la ni aku tgh wat summer class.nk kate best mmg best nk kate boring pn ade gak.ish..mende la.dlu kls byk kate xsempat nk study la, itu la, ini la.ni bila kelas dh skit alasan lain lak yg timbul.kalau dh MALAS tu mngaku je la..
haih..otak ni ligat je pikir mna nk pegi.mentang2 kunci keta ade dpn mata.tp nsb bek la makcik aku blk kmpg.kalo x tiap kali xde kls je lepak kt rmh die.he3..org lain keje kt lak sedap2 je pegi brjln..hjg mggu ni blk kmpg lak coz ade kenduri kezen aku.xblk kang bising lak famili kt kmpg tu.so kna la blk.blk kejap pn jdlah.nsb bek la bln ni aku xkuar shopping.kalo kluar pn ade org blanje.he3..so ade la skit saving.dpt la beli tiket bas blk.dlm RM80 gak.trkejuz kawan aku time aku kluar duit RM100 nk byr tiket.ha3..aku ckp kt die aku ni bernasib baik lg la ade duit elaun nk beli tiket blk kmpg.ade kezen aku tu sanggup xnk blk kmpg semata2 xnk duit diorg melayang camtu jer..ha3..mcm2 la..
eh..dh dkt kul 10 ni.study xhbs lg.esk ade kls.ok..da~wassalam...

Rabu, 10 November 2010

Yeay!!I'm free now!!

Alhamdulillah...akhirnya berjaya jugak aku menamatkan pengajian 3rd year 1st sem aku.lagi satu sem jer lagi yang tinggal sebelum aku melangkah keluar daripada monash.hurm..xsabarnye nk tggu hari tersebut.banyak sudah pengalaman yang aku lalui sebagai seorang mahasiswi di institut pengajian tinggi swasta.memang tak dapat dinafikan menjadi pelajar monash sememangnya mencabar fizikal dan mental.yang paling berkesan di hati adalah penyeksaan mental sebenarnya.kalau diri ini tak cukup kuat untuk hadapi keadaan ini silap hari bulan boleh jadi gila.tak hairan la ada jer pelajar monash yang ambik course science ambil jalan singkat dengan 'commit suicide'.Alhamdulillah kami pelajar melayu dan islam masih mampu bertahan walaupun kami sebenarnya banyak makan hati.makan hati dgn lecturer, lab demo, dan coursemate sendiri.istilah 'racist' memang sentiasa wujud dan menjadi satu trend sebenarnya di monash.malas sebenarnya nak cerita.tapi itulah hakikatnya.hanya kami saja yang tahu dan rasainya.susah untuk diceritakan pada orang lain. Walaubagaimanapun, aku tetap berbangga menjadi student monash.monash universiti tersenarai dalam QS World University Rankings dan kini berada di tempat yang ke-61.no wonder la kenapa susah sangat belajar kat sini.

Kita tinggalkan cerita monash aku di sini.kalau diteruskan banyak pulak benda yang aku nak crita pasal monash ni.hurm..kisah seterusnya adalah berkenaan dengan aktiviti aku selepas exam.hari ni dah masuk hari kedua dah aku terlepas dari bebanan exam.banyak jugak rupanya benda yang aku dan kawan2 aku nak buat.tapi memandangkan raya korban dah nak dekat terpaksa la aku cancle mana2 benda yang xpenting utk dibuat.tambahan pulak ummi ngn abah aku pun awal2 lagi dah tanya nak blk bila.kenapa tak boleh balik awal.lepas tolak2 yang mana tak patut, hari ni aku dengan kawan2 biotek yg lain bersepakat mendaki Broga Hill yang terletak dkt semenyih.mula2 nak naik bukit ni memang excited.mana taknya first time nak hike.dah terbayang diri kat puncak bukit.tapi malangnya, panas disangka ke petang hujan pulak di tengah hari.bila dah dekat berapa percent lagi nak sampai kat puncak pertama, hujan lebat tak berenti2 turun.kabus pulak menebal.memang trasa sejuk sampai ke tulang.mengiggil kat atas tu.ujian buat kami yang baru first time hiking.

Disebabkan hujan, ramai pendaki2 yang dah berada kat atas lebih awal utk menyaksikan matahari terbit berpusu2 turun.dalam kekalutan nak meneruni cerun Broga yang mengerunkan tu, ada antara pendaki yang bernasib malang jatuh bergolek2 ke bawah.memang mengerikan.disebabkan kejadian itu, kitorang mengambil keputusan untuk tidak meneruskan pendakian ke puncak bukit dan untuk mengelakkan daripada ada yang tercedera, kami berusaha meneruni cerun dengan strategi kami sendiri.arahan dari kawan yang dah selamat turun kepada kawan yang sedang turun memang sangat membantu.Alhamdulillah..dari situlah aku nampak semangat setiakawan dan kerjasama antara kami sememangnya tinggi.terima kasih yang tak terhingga buat kawan2ku untuk pengalaman yang cukup bermakna ini.walaupun jari ini masih sakit untuk menaip, tapi aku gagahkan jua jari ini untuk mengukir satu catatan pengalaman yang sangat indah untuk dikenang bersama suatu hari nanti..


-Broga Hill..Here we are!!-
-Kawan2 cuba membantu-

Rabu, 3 November 2010

fuhh..


fuhh..memang ade kick ar kali ni exam..baru 2 paper..soklannye..pergh..memang dasyat!!
hurm..ape yang penting..usaha+doa+tawakal..insyaAllah..moga Allah permudahkan bagiku utk paper yg seterusnya Plant biotech and Recombinant.moga kejayaan menyebelahiku..Amiinn..

InsyaAllah..(tinggi sungguh cita2..he3..tp why not..i'm trying to do my best and let Allah do the rest.just leave our fate and destiny to Him..insyaAllah hanya Dia yang tahu apa yang terbaik buat kita)

Khamis, 21 Oktober 2010

Special for u..hik3

Happy Birthday to u Cik!!
Semoga dipanjangkan umur dan dimurahkan rezeki. Semoga peningkatan umurmu seiring dengan peningkatan amal. Senyum sokmo. Jangan lupo ambo sini!! Akan kutunggu kehadiranmu!! Jgn lambat2 nanti xpasal2 kek ni kawe make..ha3

Ahad, 17 Oktober 2010

kawanku di monash

Sudah hampir 3 tahun aku di monash university sunway. banyak pengalaman pahit dan manis yang aku rasa.paling banyak kenangan pahit agaknya.dan sejak itulah aku mula berkenalan dengan kawan2 baruku iaitu lab report, assignment,journal dan turnitin.

Lab report adalah orang yang paling 'demand' skali di antara sahabatku yang lain.dia ni suka sangat berdamping dengan aku.memang xboleh lari la dari jumpa dia tiap2 minggu terutamanya selepas habis lab.ada jer benda yang dia nak daripada aku.kalau benda tu senang aku kasi xpe.ni benda smua nak yang mcm si journal ada.aku tahu la kau memang sanjung sangat si journal tu.tapi janganlah samakan aku dengan cik journal tu.dia tu siapa aku ni siapa.journal tu orangnya susah untuk paham ape lagi nak tiru gaya 'expert' macam dia.memang xdapat la.journal pun mula menjadi sahabat aku selepas aku kenal lab report.journal memang susah nak dekati.lagi2 nak paham perangai dia.hanya orang2 yang high level otaknya saja yang dapat rapat dengan journal.kalau mimpi nak jadi saintis boleh la ikut jejak journal.

Assignment pulak orang yang biasa2 saja.senang nak didekati.tapi kadang2 dia boleh mengganas lagi teruk daripada lab report.kalau paham dia macam mana xde la susah sangat nak berkawan dengan dia.dah la jarang2 jumpa.tapi xde la pulak rase rindu.he3..jika dibandingkan assignment dengan lab report, aku lebih suka assignment sebab dia ni xgedik dan xdemand sangat mcm lab report.jika diberi peluang untuk memilih,aku akan pilih assignment.

Turnitin..orangnya memang teruk.suka sangat cari pasal.kerja dia xlain xbukan adalah cari kesalahan orang lain.lepas tu report kat lecturer.lecturer pulak asyik dengar je cakap si turnitin ni.jarang2 lecturer jer yang xsuka turnitin.boleh dikatakan turnitin ni antara pilihan lecturer kat monash ni.aku memang xsuka turnitin.dia ni pembohong nombor satu.ada ke patut kerja yang aku buat guna ayat aku sendiri dia boleh kata aku ni tiru orang lain punya kerja.dengan kata lain dia kata aku pegi plagiarize orang lain punya hasil kerja.ada ke patut?penat2 aku karang ayat aku sendiri dia boleh lak tuduh aku macam2.macam la dia tu pandai sangat.dah la simpan hasil kerja aku xmintak permission pun daripada aku.pastu nak tuduh aku meniru lak.ish..memang teruk!!

Boleh dikatakan semua kawan aku ni suka sangat menyusahkan hidup aku.memang mereka dapat membuatkan diri aku ni rajin, tapi dari sudut yang lain mereka memang 'highly demand'.
Alhamdulillah..hari ni hari terakhir aku jumpa dengan diorang walaupun tahun depan terpaksa jumpa lagi.tapi harap2 lepas ni mereka dapat menjadi sahabat aku yang lebih baik!!

Sabtu, 9 Oktober 2010

Ketentuan Hidup

Ya Allah..jika inilah takdir hidupku..maka bukakanlah pintu hatiku ini untuk menerima seadanya apa yg datang kepadaku
Ya Allah..jika inilah kelemahan diriku..maka jangan biarkan diriku ini terus lemah
Ya Allah..jika perpisahan itu lebih baik utk diriku..maka jadikanlah perpisahan itu suatu dinding untuk memisahkan aku antara masa lalu dan masa depan
Ya Allah..jika pertemuan itu lebih baik utk diriku..maka jadikanlah ia detik yang paling menggembirakan dalam hidupku
Ya Allah..jika ini adalah kasih sayangMu..maka bukakanlah mataku supaya aku sedar akan kehadirannya dan hatiku untuk menerimanya dengan penuh keikhlasan

-sedihnya hati ini.ade je perpisahan yang bertamu.tapi aku bersyukur padaMu ya Allah kerana perpisahan itu hanyalah sekadar jarak dan kami masih boleh bersua lagi di lain masa...Ya Allah, engkau berikanlah perlindungan kepada ahli keluargaku serta selamatkanlah perjalanan abangku iji, long, kakak iparku kakti, dan anak saudaraku asyraf ke destinasi yang dituju. Moga naugan berkahMu sentiasa menginringi kami sekeluarga..Amin..-

sayunya dengar suara Asyraf mengucapkan bye2..tata padaku di corong telefon.. :(

Isnin, 20 September 2010

jagalah mulut anda..

Orang selalu kata:

"cakap tu biarlah berpada-pada" "fikir dulu sebelum cakap" "lebih baik senyap daripada cakap benda2 yg xberfaedah" "kerana mulut badan binasa" "terlajak perahu boleh diundur terlajak kata buruk padahnya" "kata2 lebih tajam daripada pedang"

Apa yang keluar dari mulut kita x semestinya menyenangkan hati orang yang mendengar.kadang2 apa yang kita sangkakan gurauan sebenarnya duri yang menghiris hati sahabat anda.memang mudah mengungkap kata.tapi awas!!kata2 anda mungkin berbisa.jangan sesekali menganggap orang yang mendengar kata2 anda faham apa yang anda maksudkan.mungkin kata2 anda disalah tafsirkan dan boleh mencetuskan perselisihan faham yang akhirnya merenggangkan tali persahabatan atau tali persaudaraan yang telah lama terbina.YA..ini mungkin dan pernah terjadi dalam hidup anda.samada diri anda sendiri penyebab atau orang lain.kata-kata yang buruk ibarat ditusuk duri yang berbisa.bukan hanya melukakan tetapi boleh bernanah.luka ni selalunya dalam dan boleh meninggalkan parut dan juga bisa berdarah kembali.

Rasulullah S.A.W. pernah bersabda:

“Waspadalah kamu dari kata-kata yang kotor, kerana sesungguhnya Allah Ta’ala tiada suka kepada kata-kata yang kotor dan perilaku yang cabul.”


Rasulullah s.a.w. pernah melarang para sahabatnya supaya jangan memaki kaum Musyrikin yang terbunuh di dalam peperangan Badar, sabdanya: Janganlah kamu memaki-maki mereka itu, yakni orang-orang Musyrikin yang terbunuh di dalam peperangan Badar itu, sebab caci-makimu itu tidak akan memberikan apa-apa kesan kepada mereka, malah sebaliknya kamu akan menyakiti hati orang-orang yang masih hidup (dari keluarga si mati itu). Ketahuilah bahwasanya kata-kata yang kotor itu adalah suatu kejahatan.

Sabdanya lagi dalam sebuah Hadis:


“Bukanlah seorang Mu’min itu yang jadi pencaci, pelaknat, bukan yang suka berkata kotor atau yang lidahnya suka menyebut kata-kata yang hina.”

Jadi, sama2 lah kita muhasabah balik diri kita ini.adakan kita pernah melukakan hati orang dan membuatkan orang tidak senang dengan ucapan kita.biarlah kita dilukai, jangan sampai kita melukakn hati orang lain.sesungguhnya bersabar itu lebih baik..

Isnin, 16 Ogos 2010

You always be there~

Always Be There Lyrics

By: Maher Zain

Alllahu Akbar…

If you ask me about love
And what i know about it
My answer would be
It’s everything about Allah
The pure love, to our souls
The creator of you and me,the heaven and whole universe
The one that made us whole and free
The guardian of HIS true believers
So when the time is hard
There’s no way to turn
As HE promise HE will always be there
To bless us with HIS love and HIS mercy
Coz, as HE promise HE will always be there
HE’s always watching us, guiding us


So when the time is hard
There’s no way to turn
As HE promise HE will always be there
To bless us with HIS love and HIS mercy
Coz, as HE promise HE will always be there
HE’s always watching us, guiding us
And HE knows what’s in all in our heart

So when you lose your way
To Allah you should turn
As HE promise HE will always be there…

HE bring ourselves from the darkness into the light
Subhanallah praise belongs to YOU for everything
Shouldn’t never feel afraid of anything
As long as we follow HIS guidance all the way
Through the short time we have in this life
Soon it all’ll be over
And we’ll be in His heaven and we’ll all be fine

So when the time gets hard
There’s no way to turn
As HE promise He will always be there
To bless us with HIS love and HIS mercy
Coz, as HE promise HE will always be there
HE’s always watching us, guiding us
And HE knows what’s in all in our heart

So when you lose your way
To Allah you should turn
As HE promise HE will always be there…

Allahu Akbar…

So when the time gets hard
There’s no way to turn
As HE promise He will always be there
To bless us with HIS love and HIS mercy
Coz, as HE promise HE will always be there
HE’s always watching us, guiding us
And he knows what’s in all in our heart

So when you lose your way
To Allah you should turn
As HE promise HE will always be there…

Allahu Akbar…

Video & Lyrics Information

Artist: Maher Zain
Album: Thank You Allah
Lyrics: Bilal Hajji & Maher Zain
Melody: Maher Zain
Arrangement: N/A
Copyright: Awakening Records 2009

Jumaat, 6 Ogos 2010

Aktivitiku

Hobi baru:
Hobi ke??erk..Hari ni genap seminggu aku drive keta kt kwsn yg memang strategik sgt dgn traffic jam.macam2 perasaan rasanya bwk keta kt area ni.hari mula2 nk start bawak keta memang sgt mendebarkan.masakan tidak sebelum ni aku xpernah pun drive seorang diri.memang mendebarkan bila aku terpaksa drive sorang2 dari rumah mak sepupuku di keramat sampai la ke rumahku dkt USJ2.tp alhamdulillah xde ape2 yg buruk berlaku.memang betul2 mencabar..

Tutorial 1 recombinant:
List the complete of bacterial gene sequence including with its promoter, shine Dalgarno, start site and open reading frame (ORF).What is difference between strong and weak promoter?What are small and large gene products of human, bacteria, drosophila, yeast, primitive and flowering plants?waaaaaaaaaaa......matila..benda ape ni?cmne nk tau betul salah?blajar pn tak hbs lg..bak kate Prof Ben.."Don't worry..I took 30 years to learn all of these.."What??kalo cmtu aku pn kna amik masa 30 thn gak la nk complete assignment ni..hu3..

Ini adalah sebahagian daripada sequence E.coli yang aku ambik daripada BLAST.aku sendiri pun xtau sequences ni stand for what kind of genes.tapi selepas bertungkus lumus mencari journal akhirnya dpt gak aku find satu gene iaitu trpE gene.siap dengan promoternye skali.dengan pertolongan dari kawan2 aku dpt gak aku kumpulkan keempat2 gene iaitu dua strong promoter dan dua weak promoter.tapi yang ni baru part A.tak masuk lagi part B.hu3..cmne lah nk jadi scientist.lama2 tgk sequence ni blh pecah kepala..


CATTATCGACTTTTGTTCGAGTGGAGTCCGCCGTGTCACTTTCGCTTTGGCAGCAGTGTCTTGCCCGATTGCAGGATGAGTACCAGCCACAGAATTCAGTATGTGGATACGCCCATTGCAGGCGGAACTGAGCGATAACACGCTGGCCCTGTACGCGCCAAACGTTTTGTCCTCGATTGGGTACGGGACAAGTACCTTAATAATATCAATGGACTGCTAACCAGTTTCTGCGGAGCGGATGCCCCACAGCTGCGTTTTGAAGTCGGCACCAAACCGGTGACGCAAACGCCACAAGCGGCAGTGACGAGCAACGTCGCGGCCCCTGCACAGGTGGCGCAAACGCAGCCGCAACGTGCTGCGCCTTCTACGCGCTCAGGTTGGGATAACGTCCCGGCCCCGGCAGAACCGACCTATCGTTCTAACGTAAACGTCAAACACACGTTTGATAACTTCGTTGAAGGTAAATCTAACCAACTGGCGCGCGCGGCGGCTCGCCAGGTGGCGGATAACCCTGGCGGTGCCTATAACCCGTTGTTCCTTTATGGCGGCACGGGTCTGGGTAAAACTCACCTGCTGCATGCGGTGGGTAACGGCATTATGGCGCGCAAGCCGAATGCCAAAGTGGTTTATATGCACTCCGAGCGCTTTGTTCAGGACATGGTTAAAGCCCTGCAAAACAACGCGATCGAAGAGTTTAAACGCTACTACCGTTCCGTAGATGCACTGCTGATCGACGATATTCAGTTTTTTGCTAATAAAGAACGATCTCAGGAAGAGTTTTTCCACACCTTCAACGCCCTGCTGGAAGGTAATCAACAGATCATTCTCACCTCGGATCGCTATCCGAAAGAGATCAACGGCGTTGAGGATCGTTTGAAATCCCGCTTCGGTTGGGGACTGACTGTGGCGATCGAACCGCCAGAGCTGGAAACCCGTGTGGCGATCCTGATGAAAAAGGCCGACGAAAACGACATT...


Isnin, 26 Julai 2010

~Wahai CINTA~

Duhai sahabat...
Cinta itu di dalam hati...
kita mempunyai sebuah rumah...
Rumah itu sentiasa dikunjungi tetamu...
Ada yang baik dan ada yang buruk.
Terkadang rumah itu cantik apabila kita kemaskan,
kita hiaskan dengan perabot KETAKWAAN,
diwarnai indah dengan warna-warna KEIMANAN bahkan menjadi perhatian jika dilengkapi dengan kelengkapan ILMU pengetahuan.
Tetamu yang baik hadir menambah perabot rumah mu, wahai kawanku...
Dia mengindahkan lagi warna pada dinding hatimu bahkan sentiasa mengajak memenuhi rumahmu dengan kelengkapan ILMU...
Dan ketahuilah duhai sahabatku...
Tetamu burukmu hanya ingin mencuri perabotmu,
merosak dinding hatimu dan melenyapkan kelengkapanmu
sehingga rumahmu roboh dan kau sendiri ditelan bumi kemaksiatan...
Suatu hari, bayu lembut menyapa telingamu,
mengkhabarkan tentang tetamu yang bernama CINTA ingin bertandang ke rumahmu...
Dan berhajat tinggal di dalam kamar hati mu...

Kau gembira mendengarkannya...
Maka tatkala sang CINTA sampai di hadapan pintu rumahmu...
Apa yang akan kau lakukan ???
menerimanya sedangkan rumah mu bersepah tak terurus ???
Dengan perabot TAKWA yang reput dan sudah lapuk tak diganti,
dan warna-warna IMAN yang luntur tak diperbaharui...
Dan hiasan kelengkapan ILMU yang masih belum mencukupi ???
Sekalipun hatimu berat...

Pintalah sang CINTA itu pulang...
Beritahulah kepadanya... :
Maafkan aku...
Aku masih belum bersedia untuk menerima kau sebagai tetamuku...Kerana...
Aku ingin menggantikan perabot
TAKWA ku kerana ia sudah reput tak bermaya...
Agar
TAKWA ku mengingatkan aku agar aku mencintaimu tanpa melupai PENCIPTA ku,
yang Maha Pengasih...
Dan kau sendiri selesa beristirehat di dalam hatiku...kerana aku ingin memperbaharui warna
IMAN pada dinding rumah (HATI)ku...
Agar hilanglah gelisahmu,
reduplah hatimu dan tenanglah jiwamu saat kau memandang
warna-warna
IMAN yang indah berseri...
Terang dan menerangi...
Kerana aku ingin menambah segala kelengkapan dan hiasan
ILMU dalam rumahku...
Agar kau selesa baring atas hamparan permaidani
HARTA kudan kau selesa dengan tutur bicara HIKMAH ku...

Kau tahu wahai
CINTA ???
Kerana setelah aku menerima mu sebagai tetamu ku...

AKU TAK AKAN BIARKAN KAU KELUAR DARI RUMAHKU BUAT SELAMANYA.......


Duhai sahabat..
... Sungguh cinta itu indah,Namun ia adalah satu anugerah apabila kita sudah mampu dan bersedia...
Tetapi bagi pelajar macam kita ???
Cinta itu biasanya hanyalah musibah...
Cintailah ALLAH...Yang sentiasa mencintaimu,
memeliharamu dan mengasihimu...
Saat mereka bertanya...Mengapa kau mencintai ALLAH ?Katakanlah wahai temanku...
Kerana ALLAH lah yang menciptakan aku,memeliharaku dalam rahim bondaku,kerana aku Mendengar namanya saat bapaku berseru di telingaku...
Kerana Dia yang menumbuhkan dagingku...
Dan mengukuhkan tulangku...
Dan sentiasa memaafkan segala salah - silapku...
Tutur bicara mulutku...
Bagaimanalah aku mampu untuk mencintai sesuatu atau sesiapa melibihi ALLAH...
Aku tak menemui alasan untuk mengingkari Nya...
Hidup dan matiku.......
Segalanya untukNya........

Isnin, 19 Julai 2010

Cabutan bertuah Power Root??

Akhirnya dapat gak aku mengupdate blogku ini...3 minggu bercuti kt kampung sungguh singkat ku rasakan.rase baru semalam aku bercuti dan sekarang kembali meneruskan perjuangan aku di monash university.hurm..tp bukan kisah percutian yang ingin aku ceritakan tapi pasal panggilan 'hangus' yang baru aku dapat dalam perjalanan aku ke monash.mungkin kisah ini dapat memberikan sedikit input yang berguna kepada kita agar berjaga2 dengan panggilan 'hangus' ini.berikut adalah perbualan telefon antara aku dan 'mamat'(bukan nama sebenar).

Mamat: Hello..assalamualaikum..
Aku: Hello..
Mamat: Maaf kalau saya mengganggu encik (kejap cik n kejap encik..yg ni aku prasan).boleh saya ambil masa cik sekejap?
Aku: Ye..ada hal ape sebenarnya?
Mamat: Cik tahu tak Power Root sekarang ni mengadakan peraduan yang membolehkan encik memenangi sejumlah wang?
Aku: Ye..saya tau
Mamat: Sebenarnya..sim kad cik telah terpilih memenangi cabutan bertuah Power Rootyang bernilai RM3000..bla..bla..
Aku: Eh..tapi sy xpernah pakai atau beli product power root ni.macam mana pulak saya boleh menang?
Mamat: Sebenarnya nombor sim kad cik telah terpilih dalam komputer kami untuk menang peraduan cabutan bertuah ni..bla2..bla..betulkah encik xpernah guna Power Root sebelum ini?
Aku: Ye..xpernah..
Mamat: Walaubagaimanapun sim kad cik telah terpilih untuk memenangi cabutan bertuah..bla..bla..betul ke ini nombor sim kad cik?019-XXXXXXX?
Aku: Ye..betul..
Mamat: Tahniah..kerana cik dan sekeluarga telah memenangi cabutan bertuah Power Root yang bernilai RM3000..bla..bla..boleh saya tahu nombor akaun encik?
Aku: Xpe la..saya xpercaya benda2 macam ni..(belum sempat aku habis cakap si mamat ni terus meletakkan phonenya)
-nombor mamat ni agak pelik..kalo xsalah aku bermula dengan +8

Itulah beberapa kerat perbualan yang aku ingat.sebenarnya panjang lagi time part si mamat ni bercakap.malas aku nak dengar.ingat nk letak je phone tapi disebabkan nak tahu cmne helah si kaki penipu ni aku terus melayan.he3..kalau ikutkan hati nk je pegi balai polis kasi kat abang polis dengar si penipu ni berceloteh panjang menipu orang.nasib baik aku xterpedaya dengan duit express ni.dalam dunia ni mana ada duit senang2 datang pada kita tanpa kita berusaha mendapatkannya..hurm..sama2 la kita mengambil iktibar dari kisah ni.jangan senang2 bagi nombor akaun kita pada orang yang kita xkenali.sebab kawan aku pernah kena sebelum ni.duit dlm akaun die lesap sejurus selepas panggilan 'hangus' ini dibuat..AWAS!!

Rabu, 23 Jun 2010

~Jom layan~

Sekadar melihat dari sudut yang berbeza. Bukan sengaja atau saja-saja untuk mencipta kelainan, tetapi sedar bahawa setiap kita ada titik buta (blind spot) masing-masing.

Dan perbezaan bukan semestinya satu pertentangan, ia hanya satu fitrah – manusia sentiasa unik. Ya, dari dimensi inilah saya melihat demonstrasi anti-Yahudi yang begitu marak sekarang.

Sejak sama-sama solat hajat di surau untuk ahli kariah kami yang turut berada di atas kapal misi bantuan yang diserang Israel itu, saya terus berfikir. Rasa marah, kecewa tetapi terus mengharap silih berganti dalam diri, yang saya pasti turut dirasai oleh kita bersama.

Palestin bukan soal ‘mereka’ tetapi soal ‘kita’. Dan hasil berfikir itu saya tumpahkan dalam sebuah artikel yang sengaja saya imiginasikan dalam bentuk dialog. Ikutilah dialog yang saya nukilkan selepas Subuh pagi tadi :

MARI KITA DEMONSTRASI HARI-HARI!

Setelah pulang daripada demonstrasi anti-Yahudi, seorang Pak Cik berbual dengan saya sewaktu sama-sama menunggu giliran mendapat rawatan di sebuah klinik.
“Puas hati. Kami dah bakar bendera Israel. Hancur luluh dibuatnya. Gambar PM Israel pun banyak yang kami robek-robekkan. Kalaulah tidak mengenangkan undang-undang, kami dah bakar kedutaan Amerika. Tapi kami masih rasional.”
Saya mengangguk-angguk kepala sahaja.

“Tel Aviv akan bergegar minggu ini dengan demonstrasi oleh seluruh dunia Islam. Dijangka banyak lagi siri demonstrasi akan diatur minggu hadapan. Awak jangan lepas peluang.”
Saya mengangguk kepala. Mungkin kerana demam, saya banyak diam. Lagipun saya telah berjanji pada diri, dalam berinteraksi perlu menjadi pendengar.
“Eh, awak tidak ada respons langsung. Baru demam sikit… janganlah begitu. Rakyat Palestin dibom, ditembak dan disekat bekalan makanan dan keperluan. Itu lagi teruk.”

Kali ini saya senyum. Saya bersuara perlahan, “saya sokong tindakan Pak Cik dan demonstrasi menyatakan pendirian kita menentang kekejaman Yahudi.”
“Bagus. Suara saya serak melaungkan takbir semalam. Dada ni sakit-sakit sejak akhir ni.”
“Kenapa Pak Cik?”
“Rokok dik. Semuanya fasal rokok ni.”
“Pak Cik hisap rokok apa?” saya mula teruja untuk berbual.
“Masih Winston. Dah sebati sejak dulu.”
Winston from America?” bisik saya perlahan.
Kali ini Pak Cik tu pula mengangguk-angguk.

“Sakit-sakit Pak cik pun masih kuat berdemonstrasi. Apa pandangan adik tentang demonstrasi ini?” kilasnya mengalih arah perbualan.
“Ada langkah yang lebih utama dan pertama daripada itu,” tegas saya.
“Apa dia?”
“Solat Subuh berjemaah.”

“Kita cakap bab jihad, awak bercakap bab ibadat.” Muka pak Cik itu mula memerah. Tangannya mula digenggam.
“Jihad dan ibadat tidak terpisah. Bahkan ibadat itulah yang akan membangunkan roh jihad yang sejati.”
“Kita mesti sanggup memikul senjata.”
“Betul. Tetapi kuakkan dulu selimut menutup umat yang masih tidur menjelang Subuh.”
“Saya tak faham.”

“Pak Cik, Israel mesti ditentang menurut kaedah yang menyakitkan mereka.”
“Apa yang menyakitkan mereka?”
“Mereka bimbang sekiranya bilangan orang Islam yang solat subuh berjemaah sama dengan bilangan orang Islam yang solat Jumaat! Ini diakui oleh cerdik pandai mereka sendiri.”
“Jadi?”
“Sebaik-baik ‘demonstrasi’ ialah didik umat ini bersolat Subuh secara berjemaah di surau-surau dan masjid. Solat itu hubungan kita dengan Allah. Jangan harap musuh akan kalah, kalau Allah tidak bantu kita. Lihat di Badar, lihat di Khandak, bagaimana Rasulullah saw dan sahabat akrab dengan Allah. Lihat pula Salehuddin, lihat pula Muhammad al Fateh, bagaimana teguhnya mereka menjaga solat dan ibadat-ibadat khusus yang lain.”
Hampir terlupa saya pada janji diri untuk lebih mendengar. Saya menarik nafas panjang. Kembali merenung Pak Cuik tersebut dengan senyuman.

“Awak rasa bakar bendera Israel tak perlu? Mana kemarahan awak?”
“Bakar bendera Israel boleh saja. Ayuh, bakarlah. Tetapi jangan membakar rokok Amerika dan sekutu Yahudi yang lain lebih perlu. Cukup kalau sebulan sahaja umat Islam berhenti merokok, mungkin jumlahnya sudah berjuta-juta ringgit. Dan wang yang terkumpul itu hantarkan ke misi bantuan kemanusiaan ke Gaza!”
“Awak sindir saya?”

“Pak Cik saya tidak menyindir. Kebanyakan umat Islam, termasuk saya, hanya bencikan Yahudi pada mulut sahaja tetapi pada tindakan tidak.”
“Saya dah bertindak. Saya dah demonstrasi!”
Lagi-lagi ke situ fikirnya.
“Pak Cik dalam Al Quran, Allah tegaskan orang Yahudi itu tidak akan redha selagi kita umat Islam tidak mengikut cara hidup mereka.”
“Siapa kata kita ikut cara hidup mereka?”

“Pak Cik, lihat betul-betul. Apakah masyarakat kita telah bangunkan cara hidup Islam?”
“Kita orang Islam. Cara hidup kita mesti Islam.”
“Tidak Pak Cik. Ramai umat Islam yang tidak amalkan cara hidup cara Islam.”
“Contoh?”
“Dedah aurat, pergaulan bebas, riba, judi, arak, tinggal solat, budaya hedonisme dan dualisme masih berakar umbi dalam masyarakat kita. Lihat sahaja unsur tahyul, mistik, seks bebas dan gosip yang mendominasi media-media umat Islam. Tidak ikut cara hidup Islam bererti terperangkap dengan cara hidup isme kapitalis, sosialis mahupun liberalis.”

Pak Cik itu terkejut sedikit, lantas menyampuk, “mana Yahudinya. Awak kata Yahudi, tapi yang awak sebut golongan hedonis, liberalis, kapitalis dan sosialis?”
“Ketiga-tiga isme itu sama.”
“Sama?”
“Kesemuanya dicipta oleh golongan yang sama… ZionisYahudi!”
“Jadi demonstrasi ini tidak berfaedah?”

Saya menggeleng-gelengkan kepala perlahan.
“Ada faedahnya. Tetapi ia bermusim dan agak bersifat agak artifisial. Kita perlu agenda yang konsisten dan ‘genuine’.”
“Misalnya?”
“Ajak orang Islam serius solat lima waktu dengan penghayatannya sehingga dengan solat itu mampu meninggalkan kejahatan dan kemungkaran.”
“Lagi?”
“Tinggalkan riba, judi, arak dalam kehidupan umat Islam. Wanita Islam didakwah dan ditarbiah secara berhikmah untuk menutup aurat dalam ertikkata sebenar dan tinggalkan pergaulan bebas!”
“lagi?”

“Pak Cik, cara hidup Islam itu terlalu banyak. Dengan mengamalkannya satu persatu kita boleh ‘berdemonstrasi hari-hari’ terhadap atas Yahudi. Bila kita boikot cara hidup berseronok-seronok yakni hedonisme, ertinya kita boikot cara hidup Yahudi yang disalurkan melalui dalang-dalang mereka di Holywood.”
“Idola Amerika?”
“Ya. Juga idola kita yang meniru persis mereka. Bangsa yang leka berhibur akan mudah dijajah.”

Pak Cik itu batuk-batuk.
Saya urut belakangnya.
“Dah lama Pak Cik batuk? Berhentilah atau kurangkan perlahan-lahan ya Pak Cik?” kata saya seakan-akan merayu.
“Semangat Pak Cik kuat, saya doakan Pak Cik berjaya. Amin.”
“Tak terfikir pula saya begitu jauh kita dibius oleh cara hidup musuh yang kita benci.”
“Kadang-kadang musuh ketawa melihat kemarahan kita. Bangunkan remaja kita untuk solat subuh berjemaah, Yahudi akan sakit hati. Tutup aurat remaja perempuan kita, Yahudi akan sakit hati. Tinggalkan riba, judi, arak, pergaulan bebas, insya-Allah, Yahudi akan gigit jari.”

“Tetapi kalau cara hidup kita mengikut telunjuk jari mereka, Zionis akan ketawa sekalipun berlambak-lambak bendera mereka kita dibakar. Jeritan Allah hu Akbar dalam demonstrasi itu baik, bersemangat tetapi ucapan takbir dalam solat lima waktu lebih besar maknanya. Apakah Allah akan nilai laungan Allah hu Akbar daripada umat yang tidak solat? “

“Eh, kami yang demonstrasi semua solat…”
“Bukan itu maksud saya. Tetapi seluruh umat Islam ini. Saya risau kerana ada kajian menunjukkan 80% umat Islam sudah tidak solat. Itu yang tidak solat langsung. Bayangkan pula yang solat tanpa ilmu, tanpa penghayatan dan tanpa khusyuk? Jadi berapa kerat umat ini yang benar-benar kompeten menghadapi Zionis dalam erti kata sebenar?”

Giliran Pak Cik itu tiba. Dia melangkah perlahan menuju bilik rawatan. Ditinggalkan sendirian begitu, saya lontarkan pandangan ke luar klinik. Terus merenung dan berfikir. Masih terbayang wajah pemimpin-pemimpin dan para pengikut yang ramai dalam demonstrasi seperti yang dipaparkan di dada akhbar dan di kaca televisyen. Alangkah indahnya jika demonstrasi dibuat seusai solat Subuh berjemaah dan sebelum itu didahului oleh qiamulail dan qunut nazilah?

Dan kemudian setelah selesai berdemonstrasi, para pemimpin dan ribuan pengikutnya itu terus sahaja mengamalkan cara hidup Islam dalam diri, keluarga, jabatan, unit, organisasi, masyarakat dan bahagian masing-masing. Bukan hari itu sahaja… tetapi hari-hari. Setiap hari!

Ah, bagaimana umat ini hendak disedarkan bahawa mengamalkan cara hidup Islam itulah cara penentangan yang paling dibenci oleh Yahudi? Firman Allah:
“Sekali-kali tidak redha orang Yahudi dan Nasrani sehingga kamu mengikut millah (cara hidup) mereka.”

Dan alangkah baiknya jika jeritan Allah hu Akbar, dibuktikan dengan penegakan hukum Allah dalam seluruh sistem kehidupan sekali gus ‘mengecilkan’ pandangan akal sendiri dalam menyusun dan mengatur kehidupan ini?

dipetik drpd:
http://genta-rasa.com/2010/06/05/mari-demonstrasi-hari-hari/

Rabu, 2 Jun 2010

I'm against zionist TERRORISM!!


Hidup2..Hidup ISLAM!!Hancur2..Hancur Kuffar!!
Hidup2..Hidup ISLAM!!Hancur2..Hancur Israel!!

Ya Allah..begitu kejam si yahudi laknatullah ini..sungguh teruk mengalahkan binatang perbuatan mereka..entah apa salah sukarelawan2 yang hanya membawa bekalan keperluan kepada rakyat Palestin terhadap mereka.sudah terang lagi bersuluh kejahatan mereka.

Marilah kita sama2 berdoa agar sukarelawan2 kita yang dlm perjalanan menghantar bantuan kemanusiaan ke Gaza dengan kapal Rachel Corrie sampai dengan selamat hendaknya dan dijauhi daripada kejahatan zionis.moga usaha murni mereka diberkati dan dibalas oleh Allah kelak..

Dan marilah kita berdoa agar musuh2 Islam yang ingin menghalangi jalan suci ini dilemahkan oleh Allah..


Rabu, 26 Mei 2010

~miss u a lot~

hu3..rindunya pd kalian..rindu pada kemanjaanmu..rindu pada kecomelanmu..thx for brightening my life~

Nur Sakinah bt. Mohd Fatah (kak ninah)
anak sepupu (2 thn 3 bln 6 hari)
sayang..hanya gmbr ni je yg tggl..koleksi gmbr2 time kecik dlu ntah ade ke tak lg dlm laptop lamaku..hu3


Asyraf Fikry b. Zool Hilmi (baby syeraf)
anak sedara
br msk 8bln smlm
gmbr Asyraf trlampau byk lak..smua comel2 tp yg ni yg plg comel!!^_^

xsabarnye nk blk!!

Sabtu, 22 Mei 2010

Harus Memilih Kawan

“Teman yang paling baik adalah apabila kamu melihat wajahnya, kamu teringat akan Allah, mendengar kata-katanya menambahkan ilmu agama, melihat gerak-gerinya teringat mati.”

Banyak sekali hadis-hadis tentang kawan/sahabat ini. Ada pula pepatah Melayu mengatakan, “Berkawan biar seribu, berkasih biar satu.” Saya lebih selesa dengan berkawan biar berpada jumlahnya, lihat kualiti, bukan kuantiti. Dan berkasih jangan cuma satu saja, kalau mampu, biar ramai. Kasihkan Allah, Rasul-Nya, pasangan (suami/isteri) , anak-anak, keluarga, kaum kerabat, jiran dan juga kawan atau sahabat.

Allah SWT mencipta makhluk di atas muka bumi ini berpasang-pasangan. Begitu juga manusia, tidak akan hidup bersendirian. Kita tidak boleh lari dari berkawan dan menjadi kawan kepada seseorang. Jika ada manusia yang tidak suka berkawan atau melarang orang lain daripada berkawan, dia dianggap ganjil dan tidak memenuhi ciri-ciri sebagai seorang manusia yang normal.

Inilah antara hikmah, kenapa Allah SWT mencipta manusia daripada berbagai bangsa, warna kulit dan bahasa. Firman Allah SWT yang bermaksud, “Hai manusia, sesungguhnya Kami menciptakan kamu dari seorang laki-laki dan seorang perempuan dan menjadikan kamu berbangsa-bangsa dan bersuku-suku supaya kamu saling kenal-mengenal (dan beramah mesra antara satu sama lain). Sesungguhnya orang yang paling mulia di antara kamu di sisi Allah ialah orang yang paling bertakwa di antara kamu. Sesungguhnya Allah Maha Mengetahui lagi Maha Mengenal.” (surah al-Hujurat [049] ayat 13)

Dalam Islam, faktor memilih kawan amat dititik-beratkan. Hubungan persahabatan adalah hubungan yang sangat mulia, kerana kawan atau sahabat berperanan dalam membentuk personaliti individu. Ada kawan yang sanggup bersusah-payah dan berkongsi duka bersama kita, dan tidak kurang juga kawan yang nampak muka semasa senang dan hanya sanggup berkongsi kegembiraan sahaja.

Terdapat ayat yang mengisyaratkan mengenai peranan dan pengaruh kawan, antaranya firman-Nya yang bermaksud: “Wahai orang yang beriman! Bertakwalah dan hendaklah kamu bersama-sama orang yang bersifat benar.” (Surah at-Taubah, ayat 119)

Pendek kata sahabat boleh menentukan corak hidup kita. Justeru, jika salah pilih sahabat kita akan merana dan menerima padahnya. Selari dengan hadis Rasululah SAW yang bermaksud, “Seseorang itu adalah mengikut agama temannya, oleh itu hendaklah seseorang itu meneliti siapa yang menjadi temannya.” (Hadis riwayat Abu Daud).

Hadis al-Bukhari dari Abu Musa al-Asy'ari, bermaksud: “Diumpamakan rakan yang soleh dan rakan yang jahat ialah seperti (berkawan) dengan penjual minyak wangi dan tukang besi. Penjual minyak wangi tidak akan mensia-siakan anda, sama ada anda membelinya atau hanya mendapat bau harumannya. Tukang besi pula boleh menyebabkan rumah anda atau baju anda terbakar, atau mendapat bau busuk.”

Apakah ciri-ciri seorang sahabat yang baik? Nasihat yang boleh diikuti dalam membina persahabatan ialah sebagaimana pesanan al-Qamah (seorang sahabat Rasulullah SAW) kepada anaknya, “Wahai anakku, sekiranya engkau berasa perlu untuk bersahabat dengan seseorang, maka hendaklah engkau memilih orang yang sifatnya seperti berikut.”

1 - Pilihlah sahabat yang suka melindungi sahabatnya, dia adalah hiasan diri kita dan jika kita dalam kekurangan nafkah, dia suka mencukupi keperluan.

2 – Pilihlah seorang sahabat yang apabila engkau menghulurkan tangan untuk memberikan jasa baik atau bantuanmu, dia suka menerima dengan rasa terharu, jikalau ia melihat kebaikan yang ada pada dirimu, dia suka menghitung-hitungkan (menyebutnya) .

3 – Pilihlah seorang sahabat yang apabila engkau menghulurkan tangan untuk memberikan jasa baik atau bantuanmu, ia suka menerima dengan rasa terharu dan dianggap sangat berguna, dan jika ia mengetahui mengenai keburukkan dirimu ia suka menutupinya.

4 – Pilihlah sahabat yang jikalau engkau meminta sesuatu daripadanya, pasti ia memberi, jikalau engkau diam, dia mula menyapamu dulu dan jika ada sesuatu kesukaran dan kesedihan yang menimpa dirimu, dia suka membantu dan meringankanmu serta menghiburkanmu.

5 – Pilihlah sahabat yang jikalau engkau berkata, ia suka membenarkan ucapan dan bukan selalu mempercayainya saja. Jikalau engkau mengemukakan sesuatu persoalan yang berat dia suka mengusahakannya dan jika engkau berselisih dengannya, dia suka mengalah untuk kepentinganmu.

Dalam memilih sahabat kita hendaklah memilih sahabat yang baik agar segala matlamat dan hasrat untuk memperjuangkan Islam dapat dilaksanakan bersama-sama sahabat yang mulia.

Remaja yang bebas lepas daripada pandangan ibu-ayah perlu berhati-hati memilih kawan. Kawan mampu membahagiakan juga menjahanamkan kita. Terdapat juga kawan-kawan yang melalaikan kita terhadap Maha Pencipta. Kawan yang baik membantu kita ke arah pencapaian matlamat, iaitu kebahagiaan di dunia dan juga di akhirat. Kawan yang tidak baik hanya membantutkan usaha kita ke arah itu.

Dalam kitab al-Hikam ada menyebut, “Jangan berkawan dengan seseorang yang tidak membangkitkan semangat taat kepada Allah, amal kelakuannya dan tidak memimpin engkau ke jalan Allah.” Dalam satu hadis yang bermaksud, “Seseorang akan mengikuti pendirian (kelakuan) temannya, kerana itu tiap orang harus memilih siapakah yang harus didekati sebagai kawan (teman).”

Sufyan Astsaury berkata, “Siapa yang bergaul dengan orang banyak harus mengikuti mereka, dan siapa mengikuti mereka harus bermuka-muka pada mereka, dan siapa yang bermuka-muka kepada mereka, maka binasalah seperti mereka pula.”

Hati-hatilah atau tinggalkan sahaja sahabat seperti di bawah:

1. Sahabat yang tamak: ia sangat tamak, ia hanya memberi sedikit dan meminta yang banyak, dan ia hanya mementingkan diri sendiri.

2. Sahabat yang hipokrit: ia menyatakan bersahabat berkenaan dengan hal-hal lampau, atau hal-hal mendatang; ia berusaha mendapatkan simpati dengan kata-kata kosong; dan jika ada kesempatan membantu, ia menyatakan tidak sanggup.

3. Sahabat pengampu: Dia setuju dengan semua yang kamu lakukan tidak kira betul atau salah, yang parahnya dia setuju dengan hal yang tidak berani untuk menjelaskan kebenaran, di hadapanmu ia memuji dirimu, dan di belakangmu ia merendahkan dirimu.

4. Sahabat pemboros dan suka hiburan: ia menjadi kawanmu jika engkau suka pesta, suka berkeliaran dan ‘melepak’ pada waktu yang tidak sepatutnya, suka ke tempat-tempat hiburan dan pertunjukan.

Ali bin Abi Thalib r.a. berkata, “Sejahat-jahat teman ialah yang memaksa engkau bermuka-muka dan memaksa engkau meminta maaf atau selalu mencari alasan.”

Kemungkinan engkau berbuat kekeliruan (dosa), maka ditampakkan kepadamu segala kebaikan, oleh kerana persahabatanmu kepada orang yang jauh lebih rendah akhlak (iman) daripadamu.

Berkawan dengan seorang bodoh yang tidak menurutkan hawa nafsunya, lebih baik daripada berkawan dengan orang alim yang selalu menurutkan hawa nafsunya. Maka ilmu apakah yang dapat digelarkan bagi seorang alim yang selalu menurutkan hawa nafsunya itu, sebaliknya kebodohan apakah yang dapat disebutkan bagi seorang yang sudah dapat mengekang (menahan) hawa nafsunya.

Bagaimana akan dinamakan bodoh, seorang yang telah dapat menahan dan mengekang hawa nafsunya, sehingga membuktikan bahawa semua amal perbuatannya hanya semata-mata untuk keredhaan Allah SWT dan bersih dari dorongan hawa nafsu. Sebaliknya, apakah erti suatu ilmu yang tidak dapat menahan atau memimpin hawa nafsu dari sifat kebinatangan dan kejahatannya.

Dalam sebuah hadis ada keterangan : “Seorang itu akan mengikuti pendirian sahabat karibnya, kerana itu hendaknya seseorang itu memperhatikan, siapakah yang harus dijadikan kawan.”

Menurut ahli syair pula : “Sesiapa bergaul dengan orang-orang yang baik, akan hidup mulia. Dan yang bergaul dengan orang-orang rendah akhlaknya, pasti tidak mulia.”

Bersahabat dengan yang lebih rendah budi dan imannya sangat berbahaya, sebab persahabatan itu saling pengaruh-mempengaruhi, percaya-mempercayai sehingga dengan demikian sukar sekali untuk dapat melihat datu memperbaiki kesalahan sahabat yang kita sayangi, bahkan kesetiaan sahabat akan membela kita dalam kesalahan dosa kekeliruan itu, yang dengan itu kita pasti akan binasa kerananya.

Hati-hatilah memilih kawan, kerana kawan boleh menjadi cermin peribadi seseorang. Apa pun berkawanlah kerana Allah SWT untuk mencari redha-Nya.

Source: From SIM Group

Jumaat, 21 Mei 2010

13 AURAT WANITA..~renungan bersama~


1. Bulu kening - Menurut Bukhari, Rasullulah melaknat perempuan yang mencukur atau menipiskan bulu kening atau meminta supaya dicukurkan bulu kening - Petikan dari Hadis Riwayat Abu Daud Fi Fathil Bari.

2. Kaki (tumit kaki) semacam hantu loceng - Dan janganlah mereka (perempuan) membentakkan kaki (atau mengangkatnya) agar diketahui perhiasan yang mereka sembunyikan - Petikan dari Surah An-Nur Ayat 31. Keterangan : Menampakkan kaki dan menghayunkan/ melenggokkan badan mengikut hentakan kaki terutamanya pada mereka yang mengikatnya dengan loceng…sama juga seperti pelacur dizaman jahiliyah ….

3. Wangian
- Siapa sahaja wanita yang memakai wangi-wangian kemudian melewati suatu kaum supaya mereka itu mencium baunya, maka wanita itu telah dianggap melakukan zina dan tiap-tiap mata ada zinanya terutamanya hidung yang berserombong kapal kata orang sekarang hidong belang - Petikan dari Hadis Riwayat Nasaii, Ibn Khuzaimah dan Hibban.

4. Dada - Hendaklah mereka (perempuan) melabuhkan kain tudung hingga menutupi bahagian hadapan dada-dada mereka - Petikan dari Surah An-Nur Ayat 31.

5. Gigi - Rasullulah melaknat perempuan yang mengikir gigi atau meminta supaya dikikirkan giginya - Petikan dari Hadis Riwayat At-Thabrani, Dilaknat perempuan yang menjarangkan giginya supaya menjadi cantik, yang merubah ciptaan Allah - Petikan dari Hadis Riwayat Bukhari dan Muslim.

6. Muka dan leher - Dan tinggallah kamu (perempuan) di rumah kamu dan janganlah kamu menampakkan perhiasan mu seperti orang jahilliah yang dahulu. Keterangan : Bersolek (make-up) dan menurut Maqatil sengaja membiarkan ikatan tudung yang menampakkan leher seperti orang Jahilliyah.

7. Muka dan Tangan
- Asma Binte Abu Bakar telah menemui Rasullulah dengan memakai pakaian yang tipis. Sabda Rasullulah: Wahai Asma! Sesungguhnya seorang gadis yang telah berhaid tidak boleh baginya menzahirkan anggota badan kecu ali pergelangan tangan dan wajah saja - Petikan dari Hadis Riwayat Muslim dan Bukhari.


8. Tangan
- Sesungguhnya kepala yang ditusuk dengan besi itu lebih baik daripada menyentuh kaum yang bukan sejenis yang tidak halal baginya - Petikan dari Hadis Riwayat At Tabrani dan Baihaqi.


9. Mata - Dan katakanlah kepada perempuan mukmin hendaklah mereka menundukkan sebahagian dari pemandangannya - Petikan dari Surah An Nur Ayat 31.
Sabda Nabi Muhamad SAW, Jangan sampai pandangan yang satu mengikuti pandangan lainnya. Kamu hanya boleh pandangan yang pertama sahaja manakala pandangan seterusnya tidak dibenarkan hukumnya haram - Petikan dari Hadis Riwayat Ahmad, Abu Daud dan Tirmidzi.


10. Mulut (suara) - Janganlah perempuan-perempuan itu terlalu lunak dalam berbicara sehingga berkeinginan orang yang ada perasaan serong dalam hatinya, tetapi ucapkanlah perkataan-perkataan yang baik - Petikan dari Surah Al Ahzab Ayat 32. Sabda SAW, Sesungguhnya akan ada umat ku yang minum arak yang mereka namakan dengan yang lain, iaitu kepala mereka dilalaikan oleh bunyi-bunyian (muzik) dan penyanyi perempuan, maka Allah akan tenggelamkan mereka itu dalam bumi - Petikan dari Hadis Riwayat Ibn Majah.

11. Kemaluan - Dan katakanlah kepada perempuan-perempuan mukmin, hendaklah mereka menundukkan pandangan mereka dan menjaga kehormatan mereka - Petikan dari Surah An Nur Ayat 31.
Apabila seorang perempuan itu solat lima waktu, puasa di bulan Ramadan, menjaga kehormatannya dan mentaati suaminya, maka masuklah ia ke dalam Syurga daripada pintu-pintu yang ia kehendakinya - Hadis Riwayat Riwayat Al Bazzar. Tiada seorang perempuanpun yang membuka pakaiannya bukan di rumah suaminya, melainkan dia telah membinasakan tabir antaranya dengan Allah - Petikan dari Hadis Riwayat Tirmidzi, Abu Daud dan Ibn Majah.

12. Pakaian - Barangsiapa memakai pakaian yang berlebih-lebihan terutama yang menjolok mata , maka Allah akan memberikan pakaian kehinaan di hari akhirat nanti - Petikan dari Hadis Riwayat Ahmad, Abu D <> aud <> , An Nasaii dan Ibn Majah.
Petikan dari Surah Al Ahzab Ayat 59. Bermaksud : Hai nabi-nabi katakanlah kepada isteri-isterimu, anak perempuanmu dan isteri-isteri orang mukmin, hendaklah mereka memakai baju jilbab (baju labuh dan longgar) yang demikian itu supaya mereka mudah diken ali . Lantaran itu mereka tidak diganggu. Allah maha pengampun lagi maha penyayang.
Sesungguhnya sebilangan ahli Neraka ialah perempuan-perempuan yang berpakaian tetapi telanjang yang condong pada maksiat dan menarik orang lain untuk melakukan maksiat. Mereka tidak akan masuk Syurga dan tidak akan mencium baunya - Petikan dari Hadis Riwayat Bukhari dan Muslim. Keterangan : Wanita yang berpakaian tipis/jarang, ketat/ membentuk dan
berbelah/membuka bahagian-bahagian tertentu.


13. Rambut
- Wahai anakku Fatimah! Adapun perempuan-perempuan yang akan digantung rambutnya hingga mendidih otaknya dalam Neraka adalah mereka itu di dunia tidak mahu menutup rambutnya daripada dilihat oleh lelaki yang bukan mahramnya - Petikan dari Hadis Riwayat Bukhari dan Muslim.


Wasallam.

BIRO AGAMA & KEBAJIKAN
KELAB REKREASI TOURISM MALAYSIA

Ahad, 16 Mei 2010

ORANG IKHLAS ITU TERTINDAS?

Salam..cerita dibawah ini sy dpt dari email yg diforwardkan kepada sy oleh seorang rakan.moga kita sama2 menghayati isi kandungannya..


Jika kita memberi kebaikan kepada seseorang, kebaikan itu akan dibalas walaupun yang membalasnya bukan orang yang kita berikan kebaikan itu. Hakikat ini mengingatkan saya kepada satu perbualan yang berlaku sewaktu saya mengendalikan program latihan beberapa tahun lalu di sebuah organisasi.

“Saya tidak mempunyai apa-apa harapan lagi pada organisasi ini,” kata seorang kakak berterus-terang.
“Mengapa?” balas saya.
“Organisasi ini dipenuhi oleh kaki bodek dan kaki ampu. Saya terseksa bekerja secara ikhlas di sini. Tidak pernah dihargai, tidak ada ganjaran yang wajar.. Saya bukannya orang yang bermuka-muka. Tak pandai saya nak ampu-ampu orang atas, Fokus saya kepada kerja sahaja.”

Kakak itu sebenarnya adalah peserta program yang paling senior. Telah berpuluh tahun bekerja dalam organisasi tersebut. Itu adalah kali terakhir dia mengikuti program latihan.. Enam bulan lagi dia akan bersara. Kesempatan yang diberikan kepadanya dalam sesi memperkenalkan diri itu telah digunakannya sepenuhnya untuk meluahkan rasa kecewa dan marahnya sepanjang berkhidmat di situ. Sungguh, dia kecewa sekali. Siapa tidak marah, jika bekerja secara ikhlas dan gigih tetapi tidak pernah dinaikkan pangkat atau mendapat kenaikan gaji?


Sewaktu rehat, sambil minum-minum dan berbual santai saya bertanya kepadanya, “kakak punya berapa orang anak?”
Sengaja saya bertanya soal-soal “di luar kotak” agar ketegangan dalam sesi sebelumnya dapat diredakan.
“Oh ramai encik…”
“Bagaimana dengan anak-anak kakak?”

Wah, saya lihat dia begitu ceria apabila mula menceritakan tentang anak-anaknya. Boleh dikatakan semua anak-anaknya berjaya dalam profesion masing-masing. Ada yang menjadi doktor, jurutera, pensyarah dan sebagainya. Malah seorang anaknya telah menjadi hafiz.

“Kakak, boleh saya bertanya?”
“Tanyalah encik…” ujar kakak itu sambil tersenyum. Mendung di wajahnya sudah berlalu. Dia begitu teruja bila bercerita tentang anak-anaknya. Memang, semua anak-anaknya menjadi.
“Jika kakak diberi pilihan, antara anak-anak yang “menjadi” dengan naik gaji, mana yang kakak pilih?”
Belum sempat dia menjawab, saya bertanya lagi, “antara kakak naik pangkat dengan anak-anak berjaya dalam karier mereka, mana yang kakak pilih?”
Dengan cepat kakak itu menjawab, “hati ibu encik… tentulah saya pilih anak-anak saya menjadi walaupun tidak naik gaji atau dapat pangkat. Anak-anak adalah harta kita yang paling berharga!”
Saya tersenyum. Hati ibu, begitulah semestinya.
“Kakak, sebenarnya keikhlasan dan kegigihan kakak bekerja dalam organisasi ini telah mendapat ganjaran…” kata saya perlahan. Hampir berbisik.
“Maksud encik?”
“Allah telah membalas dengan ganjaran yang lebih baik dan lebih kakak lebih sukai. Bila kakak ikhlas bekerja dalam organisasi ini, Allah berikan kepada kakak anak-anak yang menjadi.”
“Tidak pernah saya terfikir begitu encik…”
“Allah Maha Berkuasa. Ada kalanya takdir dan perbuatan-Nya terlalu misteri dan rahsia untuk dijangkau oleh pemikiran kita. Tetapi yakinlah what you give, you get back. Itu hukum sunatullah dalam hubungan sesama manusia. Kebaikan yang kita buat akan kembali kepada kita. Yakinlah.”
“Walaupun bukan daripada seseorang atau sesuatu pihak yang kita berikan kebaikan itu?”
“Maksud kakak?”
“Macam ni, saya buat kebaikan kepada organisasi tempat saya bekerja, tapi Allah berikan kebaikan kepada keluarga. Pembalasan Allah bukan di tempat saya bekerja, sebaliknya diberikan dalam keluarga saya. Begitukah encik?”
“Itulah yang saya katakan tadi, takdir Allah kekadang terlalu misteri. Tetapi ketetapannya mutlak dan muktamad, siapa yang memberi kebaikan akan dibalas dengan kebaikan. Dalam istilah biasa itu dipanggil golden rule!”

Kakak itu termenung. Mungkin memikirkan pertalian dan kaitan antara apa yang berlaku dalam organisasi dengan familinya.

“Metafora atau analoginya begini. Katalah kita sedang memandu di satu jalan yang mempunyai dua atau tiga lorong. Penuh sesak. Tiba-tiba sebuah kereta yang tersalah lorong di sebelah memberi isyarat untuk masuk ke lorong kita. Kerana simpati melihat dia terkial-kial memberi isyarat, kita pun beralah, lalu memberi laluan untuk kereta itu masuk di hadapan kita…”


Saya berhenti seketika mengambil nafas sambil mencari reaksi. Saya lihat kakak itu mendengar penuh minat. Dia meneliti metafora yang saya sampaikan dengan begitu teliti.

“Kemudian kita terus memandu ke hadapan. Mungkin sejam kemudian atau setelah berpuluh-puluh kilometer, tiba-tiba kita pula yang tersalah lorong. Kita pula yang memberi lampu isyarat untuk masuk ke lorong sebelah. Soalnya logikkah kalau kita mengharapkan kereta yang kita bantu sebelumnya memberi laluan untuk kita?”

Kakak itu tersenyum dan berkata, “tak logik encik. Kereta yang kita bantu tadi entah ke mana perginya.”
“Tapi ada tak kereta lain yang simpati dan memberi laluan untuk kita?’
“Pasti ada! Insya-Allah.”
“Ya, begitulah. Padahal kereta itu tidak pernah sekali pun kita tolong. Tetapi Allahlah yang menggerakkan hati pemandunya untuk memberi laluan kepada kita.. Orang yang kita beri kebaikan, tidak ada di situ untuk membalas kebaikan kita… Tetapi Allah menggerakkan hati orang lain, yang tidak pernah merasa kebaikan kita untuk membalas kebaikan kita tadi.”
“Subhanallah!”
“Begitu dalam litar di jalan raya dan begitu jualah litar dalam kehidupan manusia. Kita buat baik kepada A, tetapi kerap kali bukan A yang membalas kebaikan kita tetapi B atau C atau D atau lain-lainnya yang membalasnya. Inilah hakikat yang berlaku dalam kehidupan ini.”
“Kita tidak boleh kecewa bila keikhlasan kita dipersiakan?” tanya kakak itu lagi. Lebih kepada satu respons minta diiyakan.
“Kakak, ikhlas sebenar tidak pinta dibalas. Tetapi Allah Maha Kaya dan Maha Pengasih, siapa yang ikhlas akan diberi ganjaran walaupun mereka tidak memintanya kerana setiap kebaikan itu akan dikembalikan kepada orang yang melakukannya. Ia umpama bola yang dibaling ke dinding, akan melantun semula kepada pembalingnya!”
“Selalunya saya dengar, orang ikhlas akan dibalas di akhirat.”
“Itulah balasan yang lebih baik dan kekal. Tetapi saya katakan tadi, Allah Maha kaya, Allah mahu dan mampu membalas keikhlasan hamba-Nya di dunia lagi.”
“Maksud encik?”
“Orang yang ikhlas akan diberi ketenangan dan kebahagiaan dalam hidup. Anak-anak yang soleh dan solehah. Isteri yang taat atau suami yang setia. Dan paling penting… hati yang sejahtera. Inilah kekayaan dan kelebihan yang lebih utama daripada pangkat, gaji dan jawatan.”
“Jadi orang ikhlas akan terus ditindas, tidak dapat kenaikan pangkat atau gaji? Bukan apa, saya terfikir kenapa nasib kaki ampu dan kaki bodek lebih baik dalam organisasi. Mereka dapat naik pangkat!”
Giliran saya pula tersenyum.
“Tidak ada kebaikan yang akan kita dapat melalui jalan yang salah. Percayalah, kalau benar mereka kaki ampu dan bodek sahaja… pangkat yang mereka dapat akan menyebabkan mereka melarat. Gaji naik, tetapi ketenangan hati menurun. Ingat apa yang saya kata tadi, what you give you get back… Golden rule itu bukan untuk kebaikan sahaja, tetapi untuk kejahatan juga. Kalau kita berikan kejahatan, kejahatan itu akan kembali semula kepada kita. Kaki ampu, mungkin akan dapat anak yang pandai bermuka-muka. Kaki bodek mungkin dibalas dengan isteri yang berpura-pura!” terang saya panjang lebar.
“Jadi apa yang harus saya lakukan dengan baki masa perkhidmatan yang tinggal tidak beberapa bulan lagi ni?”
“Bekerjalah dengan gigih. Walaupun mungkin bos tidak melihatnya, tetapi Allah Maha Melihat. Bekerja itu satu ibadah. God is our “ceo”, kata orang sekarang. Insya-Allah, satu hari nanti manusia juga akan diperlihatkan oleh Allah tentang keikhlasan manusia yang lain. Jangan berhenti memberi kebaikan hanya kerana tidak dapat penghargaan…”
“Maksud encik?”
“Jangan mengharap terima kasih daripada manusia atas kebaikan yang kita buat kepadanya.”
“Kenapa?”
“Kita akan sakit jiwa!”
“Kenapa?”
“Kerana umumnya manusia tidak pandai berterima kasih. Lihatlah, kalau kepada Allah yang Maha Memberi pun manusia tidak pandai bersyukur dan berterima kasih, apalagi kepada manusia yang pemberiannya terbatas dan berkala. Sedikit sekali daripada manusia yang bersyukur,” balas saya mengulangi apa yang maktub dalam Al Quran.
“Tetapi Allah tidak berhenti memberi… “ kata kakak itu perlahan.
“Walaupun manusia tidak berterima kasih kepada-Nya. Sekalipun kepada yang derhaka dan kafir, tetapi Allah terus memberi… Justeru siapa kita yang tergamak berhenti memberi hanya kerana tidak mendapat penghargaan dan ucapan terima kasih?”
“Ah, kita terlalu ego…”

Dan itulah kesimpulan perbualan yang saya kira sangat bermakna dan besar impaknya dalam hidup saya. Saya terasa “diperingatkan” semasa memberi peringatan kerana pada hakikatnya saya juga tidak terlepas daripada lintasan hati oleh satu pertanyaan… orang ikhlas tertindas?

Wasalam


Related Posts Plugin for WordPress, Blogger...