Jom Click

Jumaat, 6 Ogos 2010

Aktivitiku

Hobi baru:
Hobi ke??erk..Hari ni genap seminggu aku drive keta kt kwsn yg memang strategik sgt dgn traffic jam.macam2 perasaan rasanya bwk keta kt area ni.hari mula2 nk start bawak keta memang sgt mendebarkan.masakan tidak sebelum ni aku xpernah pun drive seorang diri.memang mendebarkan bila aku terpaksa drive sorang2 dari rumah mak sepupuku di keramat sampai la ke rumahku dkt USJ2.tp alhamdulillah xde ape2 yg buruk berlaku.memang betul2 mencabar..

Tutorial 1 recombinant:
List the complete of bacterial gene sequence including with its promoter, shine Dalgarno, start site and open reading frame (ORF).What is difference between strong and weak promoter?What are small and large gene products of human, bacteria, drosophila, yeast, primitive and flowering plants?waaaaaaaaaaa......matila..benda ape ni?cmne nk tau betul salah?blajar pn tak hbs lg..bak kate Prof Ben.."Don't worry..I took 30 years to learn all of these.."What??kalo cmtu aku pn kna amik masa 30 thn gak la nk complete assignment ni..hu3..

Ini adalah sebahagian daripada sequence E.coli yang aku ambik daripada BLAST.aku sendiri pun xtau sequences ni stand for what kind of genes.tapi selepas bertungkus lumus mencari journal akhirnya dpt gak aku find satu gene iaitu trpE gene.siap dengan promoternye skali.dengan pertolongan dari kawan2 aku dpt gak aku kumpulkan keempat2 gene iaitu dua strong promoter dan dua weak promoter.tapi yang ni baru part A.tak masuk lagi part B.hu3..cmne lah nk jadi scientist.lama2 tgk sequence ni blh pecah kepala..


CATTATCGACTTTTGTTCGAGTGGAGTCCGCCGTGTCACTTTCGCTTTGGCAGCAGTGTCTTGCCCGATTGCAGGATGAGTACCAGCCACAGAATTCAGTATGTGGATACGCCCATTGCAGGCGGAACTGAGCGATAACACGCTGGCCCTGTACGCGCCAAACGTTTTGTCCTCGATTGGGTACGGGACAAGTACCTTAATAATATCAATGGACTGCTAACCAGTTTCTGCGGAGCGGATGCCCCACAGCTGCGTTTTGAAGTCGGCACCAAACCGGTGACGCAAACGCCACAAGCGGCAGTGACGAGCAACGTCGCGGCCCCTGCACAGGTGGCGCAAACGCAGCCGCAACGTGCTGCGCCTTCTACGCGCTCAGGTTGGGATAACGTCCCGGCCCCGGCAGAACCGACCTATCGTTCTAACGTAAACGTCAAACACACGTTTGATAACTTCGTTGAAGGTAAATCTAACCAACTGGCGCGCGCGGCGGCTCGCCAGGTGGCGGATAACCCTGGCGGTGCCTATAACCCGTTGTTCCTTTATGGCGGCACGGGTCTGGGTAAAACTCACCTGCTGCATGCGGTGGGTAACGGCATTATGGCGCGCAAGCCGAATGCCAAAGTGGTTTATATGCACTCCGAGCGCTTTGTTCAGGACATGGTTAAAGCCCTGCAAAACAACGCGATCGAAGAGTTTAAACGCTACTACCGTTCCGTAGATGCACTGCTGATCGACGATATTCAGTTTTTTGCTAATAAAGAACGATCTCAGGAAGAGTTTTTCCACACCTTCAACGCCCTGCTGGAAGGTAATCAACAGATCATTCTCACCTCGGATCGCTATCCGAAAGAGATCAACGGCGTTGAGGATCGTTTGAAATCCCGCTTCGGTTGGGGACTGACTGTGGCGATCGAACCGCCAGAGCTGGAAACCCGTGTGGCGATCCTGATGAAAAAGGCCGACGAAAACGACATT...


2 ulasan:

azian azman berkata...

wuhoo..
siap letak sequence..
seb bek x letak smpai stop codon..
nak termuntah aku tgk huruf byk2..
nta pape sajek..

p/s: mak, belikan buku ABC yg ade gambo bunga2 tu ea..yan kena blaja balik sequence ABC ni..

eilah_1912 berkata...

tau xpe.ni baru permulaan.die xajar lg bioinformatic.kalo dh msk tu ak xtau la cmne nt..hu3..

p/s: belikan sekali kanta pembesar.kot2 nt brtmbh rabun mata ni..hu3

Related Posts Plugin for WordPress, Blogger...